Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ307192
Length 417 bp
Fasta Format > rwhyd10f11
acacccgctcgagacgggtatcatggaaacttgaaaattcatcactcaag ctacatatagattacatggtaaattgagcccagctgggagggaaactgag gtggacaaagtgaaatatacacatcactgcagcttgctactttactctga tttcttttcctttcccctccaaggggtcaggcatgctagcaaccgcaaca tacaccaggctggccggtgcaacttgttactctctactgaatagtacgct tatatgggctggaagcccttcagccgttgatgtggntaaccatccacagt ggaagccccgtccggggtggggcccttccgtcaattcctttaagtttcan ccttgcgaccatactccccccggaacccaaagactttgatttctnataag gtgccggcggagtccta
Download
page-top