Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ307188
Length 436 bp
Fasta Format > rwhyd10f04
cgcgacttaatatcttaataatnaattcggtacagcactgagcgactgcg gctcgtctttgcgctgatacagatagaactaactgtgcgcttacgtgcgc agcagctatgtccgggccgaatcttccgtaaacaagaacagaaattggca ctagtaaactagtaggtagatcaggtaggcaacataactacaggtttcca tacagaaccaatggtgtgcttacaaaatatcatcaacgggcgactgcagc agaacccttcacgtcgaacggagatcccaacggcgcgatcaggcccaggc tctgcatgatcttgatctggcgcacgctacgctgctccgatccccccgcg cccaggagaagagttggggtccttggtctccggctttgccgccttgccct ttctaggtttcttcttcgcagcacggcttgagtcag
Download
page-top