Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ307176
Length 659 bp
Fasta Format > rwhyd10e09
gggaactgcaaaaatgtcgtataaaacaagcctcaattcagcaggattac aggaaatgacaaaatggttatgtcttacaagagtcgatctaagactggct aataatcataaatacttgtaggctcatgatgttattagggaaccagtcga tcttttttgcttctccttcgggcaggatattgattttcactcttcttgct tgttcctgcaggtctattgttaaccttatttaggagaagggctcctcact cttgcaccacgggaaccggctgcaaagctcaagagcactttcttcttctt cctgaaaaaggaacttcctttcactttcacgacaattgatttgaggccaa tcttgctggcggatcgccccatgtgttcccctgttgcttcaccggcatac cgagcaagacgagaccgcccttttcgatcctccaagcagccagcagaagc ccgggccttcctgttctccttgacgtccttaacggtcacaaaggtctttt tctccttgggtgtgatgcgtagaacatctatctttactcgcagagccgct gtccacgttatttccatgtttaatcggccagacctgctaccgccgcctgt gaaatcattttcagcaaagcgacggtaaatgctgtcattctgcttccgtg tttgcatga
Download
page-top