Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ307171
Length 485 bp
Fasta Format > rwhyd10e01
tacttaaaagatgtacagcaagacatgagcaaagtaacgatatgcggacc gctaaggagaagctaatatcgaacagcaggaaagcagaaccggacacaaa caacctggctccgttctcaacaatcagtcacctcaaaccattttttacat ctaacgtataacaacgcatgctatctatcgaagctttgactcgttggttt tgctgctccggaagtttgagagggagaagaatgaccttgatgctgcttta gttgacggtgcagctccaggcctgtcccgtagcctatccgagcttgtggc attgaagctgctggtcgttgattgagctgataagatgctattagtcttgg aaccatcaaaagttctcctgctggaatttacaccatcactagcaccggat tcttcttgttcatcctctccatcagaaatcaccgatgggcttgccaaacc attagtgttgntgtctcctttgtttttccgagcaa
Download
page-top