Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ307167
Length 475 bp
Fasta Format > rwhyd10d21
aaacttcntgtgaatttttgttgtccggcacacatttattatatgttcac cataaccgaagtaacagtcaccgaaagagctgaggaactagttatcacca taaggtgacatgcttactgcaagcctggtactacaacaaatgtttacaac aacaagaacgagaggcaactagaagatcactcgacaatgtccgacacatc tcagagttggtcttgagggttttttcttgaacagccatactcttgtcgaa agccaccttcgaccatactgcaaaccaaagcttctgactgatccaacata aatcattcatggtctggattgccttttagcttaagctcaacttctagctc cttgtgctttagctgaagttccaaacgcttgttctcgagcatcatttctt cattctccgattccatcctttcaatttccctgtccttcttcctcttgaat ctctcccactttagacgttgctctg
Download
page-top