Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ307166
Length 416 bp
Fasta Format > rwhyd10d20
cactgtttcgacactgaatttaagtcctagataggttctttgccaccgtc acgatcccaagcactgctccgcttacttgaagcacttggcgtccagcaag gcctgcccctcgaacggctcaaggtcctcgatcatggcttccacgcgctt cttctgggcctcgtcagagaggtcaaccttggtccactcgtagagctcca tgtcatagacctccttcatgacgaactcagggatgtcctgcccacggaag agccacagccccttgaccttgaagggcgcctcagaaccaatcacgagcat cttgccaaaagcatacttgcggcacagatccatccgctgcaggaacccgc cgaccttgttcagggtcacgtacgacacggtgttctcttcctggtacttg tagtcacagaaccacc
Download
page-top