Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ307165
Length 365 bp
Fasta Format > rwhyd10d19
tattttttcnatctgagctcacattgcatgcatgcagagatgaagctgga aactggaagtgtgtgcatagatagtgtccacagcgtgccttttactagaa gtttattgcatggcaactgctaagtgtcttggtgacaccagaaggataac agctcccggactcgagccgctgcggcgttgtgaggggcaacgacagcagc ctggtttattgcgtgggctggatgctgcaccatgcatccgtgcctgctgc tgttctacagggaagaaccagcacggcgacgcctcgttgcgtttgatgca gcgatctgaccgagctcctcgccctggttagatgccactcgttccctcac aggggtgtagtgcct
Download
page-top