Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ307158
Length 628 bp
Fasta Format > rwhyd10d06
agctttagatncaaccaaacaggaaaaacattctcagttcaacctaggac tcgaacagtttacagaaaatggtgttcagtatgtctgcaaacatgacatg gacgcaacatctaagaaaatccaacaagtaacatgcagcagctcttcagc ctaagctgtggcacccttgcccttcttcttctggagcttcctcatgtaga actccagctccttgccctccaggatgtacccatcagctctgccacactgt ccagggcgagacgaaatgcaggccagcagccttccaccgctgaactgctc ctcaatgtgagagtccagtgtacgtccctgctggcgcttctcaagcttcc tctggacattgttgctcttctttgcttcctctgtggcagcagcagcaacc tcagactcttgtccctcagcagcatccttcttggcagctgcagcagcttt cttcttcctaccgatttccactccataatgagtcaggtaccactgcttga aaggggcagcatcaacttgcacaatggcattcttgacaagggtctgagtc ctcacaagctcattgtttgacgaattgtaaaccacatccaggagacgggt cttgcgggtcacagcctcactaccccat
Download
page-top