Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ307154
Length 425 bp
Fasta Format > rwhyd10d01
acagtactccgatgttgtttacctccagaccccccctcaggctatggcac agaaccatagcctcacaagttctttcacttcttacattttactctagttc taaaggtagcatacgacatagaacagccaggctgcagcaagctccttcta agggccaggaaagcaccctccggtctggtgaagcatggcgtcgatctcgt cgccttcctccatctcaagctcatcaggggtctgctcaccacggagccta cgaccatcaaaaaggaaagcaatggagttgagatccacagactgacggtc gcagtaagcgttcatcagcttcttcagctgtgtggatctcttgatgcgga agaaaacctcattgccatcctgccccttgaccttgaggntgatgtgggcg cctccaccgtcgcccgcgggcttct
Download
page-top