Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ307147
Length 343 bp
Fasta Format > rwhyd10c16
gatatatagaaatggtatcnatccgtcctcaacaaacatgccgtcacagc gacaaagattcttaatatgtagcaaatgctcatcacaactgtcaaatttc agcagcatcttcatcaacatgtacctttctttccctgtctcctttgcgca tatctgtagctagctgctaattaggagccatcatctcaagaagaagaaga aaataattaggggccatctcactgtctcagcaaaatagcttcttaatctc aggcatgcgccaccctaatcttgcaaatgctcatcacaactgttacattt cagtgccaccttcttcatcttggagttccaaggatgaggcttc
Download
page-top