Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ307137
Length 199 bp
Fasta Format > rwhyd10b24
tgcttattntgcctcattgtcctctccctatcaacacccctgacaaacta attaccgcagccagccggaagccaatgaaaagtaacacaatacaccctgc gagacaggaatcaaccaacggccggcggacgtccgtctactgagaaagaa agagtacactcagatggagacgctgttggggatgcccatggcggtgagc
Download
page-top