Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ307130
Length 556 bp
Fasta Format > rwhyd10b15
tttnaatgggaatggggaggcagtgcgggtacagaggatacaggagaagg tggcatttgaggagaatatatacagtacatgagggatttagaagcaagca tgcttccctcctacaggaagcatgataacttcttgacactgtttcacaca ccaggatcgtcatcatcagaagattacgcggtggcagctgcagcttcctc cgccacctgggatgcctgctgcagagtgcagatcaggttgcgatccccgt acacgttgtccacacgacatgtcgttggccagaacttggcaccccgaagc cacgccgccgggaacgcagcatactccctagagtatggcttagtccatgc gtcacccatcaagagttggggtgggtgaggagcgcccttcaggacattgt tgtgcgcatctgctttgccattttctacctgtgcaatttcctccctgata gagataagggcatcacagaacctgtctagttcagccttgctttcactctc agtgggttcaatcataantgtgcctggaacaggccatgacatggttggtc catgga
Download
page-top