Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ307124
Length 506 bp
Fasta Format > rwhyd10b08
cttagtttaacgaaattaatagcgcattacacagaaacttttgtcnttaa aaagtaagataggtaaccaagcgttgcatagccctcgcttatcacaggga tagaaaactagctaggaccaaaatgatgtgacgtttcatggtctgcttgc tctattgggacttcagacctcaaccaaagcaggggggcgcagctcgtcct cctccttaggggggtggatggtgacgaggtcaggcagcggggtggtaggg ccaagcttgcccttggggtcccagtcaagcataatcttcaccttgatacc aagaacgccctgtctgagaagaacgtgcctaactgcagcatcaatgtact cgttgacgggctgaccagatgagatcatgtacccgtccttgaacttcatc gacttggctctctgggccctgagcttgccgctcacaatgacctcacaacc cttagcaccactctccataacaaagcgaagaacaccatagcatgccctgc ggacgg
Download
page-top