Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ307121
Length 508 bp
Fasta Format > rwhyd10b05
gaaatgaaactgcaaatgggtatcaaatgtttcacaatctctgatgtcac ggcggcagaaggatttcaagtactctaaaacatttagctagaagggacta aaccattgatcataaccaccaacaaaaatattttccttgtttacagaaca ccatcgcacttcgcacttctgtttcaaacagattactttgaggtcgtctt gtccttggtcttctgtattttcaacaccttcttcacgatcttctgctcct caaccaagaaagcgcggatgatcctttccctcactgcagttccagagagc actccaccatagggacggttcacagtcctgcggttcctagacaaccttga tcttttgtattcagtaggccctgaggtggggaatcccctggatcttcttc ccggtcacagggcacttggggccgctcgccctcttcttggtgtactggta cactagcttaccaccctggggtcttgacgaccccgcgtctggttggactt ggtggcat
Download
page-top