Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ307111
Length 315 bp
Fasta Format > rwhyd10a15
atacgcagatcaaaacacctcgaacttaagccttgagttcaaaacattac ttgccacaagtaacagatctaaaagacataaagcataatataggggtacg atgacgatgcggaggaacctaggcgcggttgccaccgcggggtccgttga agggctggcggtagggggcggcggcagaggtggtttcgggggcgcgctcg acgccggggaggtcagccatgccgaggaacgccagcatgtccatggtctc cttgtcgacgcggatctcgtcgacctcgagcgccgacttctccggcacga agtccatgcggcgct
Download
page-top