Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ307106
Length 719 bp
Fasta Format > rwhyd10a06
cccctacctttacacagacatcatcagttagcgctaaagcctgtcgctcg ctgttctttcgggtcagtcaaacctcgacggattgcattcccgccctccg cccccagtggaacgcaaaggcagccgcacagacttaatacacttttggcc aacaaaaaacatagcacgttgcgctgcactgcgttcaccagggaaagggg agcgagggaggggcaaccgggctcaaaatatgaactaataaccaaaaaat aaaaggagagctgatgttccgaaaggaagcgacgagcatcgtcgtatgct atcttctctttcgccgttctctcgagccggacggggaggtcaaaaatggc gctggcagcttcactgttaatgtagtcgacatggtcggtgcctcggacca gatcaggtcaggtcgtcctatgagcagaacagcctcctcttgactctcga cgactcctgtacagcttccagagtctccgccaacgaattctgctttgcca ccgtcgcatgcagtgctcttttggtcctctccaggtcggcctcgatggat ctgatgcgctcgaacgagttcagtaactgttgctccttgtcctcaggcat ctctggtggcttgcttgcaagatggttgcacacagactcaagattttcaa tgcgctgtaagcaagcactcatctcatcagcaccgatggttcggggctgc ggcttctctgcagctggga
Download
page-top