Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ307104
Length 628 bp
Fasta Format > rwhyd10a04
tacgagcaaacataggtacatacactcagataccacaacatcacgctaat gaccaccacacaatgacagaaatatatataggtcacatactcaggtacca caccatcacacagctaattaatgaagacaaactcgcgctaagtaagcacc acaactgatcgagtgatcgagcgagttataaatgacggcagctagttgtg gtcgttgatctgctcgacgagtccgaggttgatgatgccccaggcagagc gcggccattgtttctccttggccttgtccctcatcaccctcccccacgac acccacccctcccacgacatcctcttgtcccagctgctgccccactccag caccagcctcagcccctccgccgccgccgcctccgcctcctcccacctcc ctccttcgttcagcagcacctgagccagcaccagccacggctcccccacg tacgggttcttcacgatgcagcgccgcagcagcgactccacgccctcctt gccgtcgctgcagatcgcctcccagtacaggtccctcgccgcgatctgct cgccggggtccagcaccttgctgcaccggtcgaacacgggcgggatgcag agctccagcccctcgtccttgttcgtcc
Download
page-top