Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ304591
Length 594 bp
Fasta Format > whyd9m23
gccaactcctcacttgtgacccctcctgagtatgcatcagtgggatcaaa gatcttctccaccttcgtcacgttcttgaagagcaaggatgccagcgatg gttcggagaaggcacttgttgacgagctgcaggcactcgaagagcacctg aaggcccatggaccctacatcaacggggcgaacatctccgccgtcgatct cagcctggctccgaagctctaccacctccaggtcgccctggagcacttca agggctggaaggtccctgaaaccctgaccagcgtccatgcctacaccgag gctctcttcagccgcgagtcgttcgtcaagaccaaggcgaccaaggagaa cctgatcgccgggtgggcgccgaaagtgaacccgtaagccctcccgccgc ttggagacccgacccacccccattgtgtcggtagtgatgggcagcagtag gccctgtctaggttggaataattcgagccttgatgtgctctggttgtcgc aagcgtgcactctgcgtggactgtcccttgcctggcttgtgtgtgtgggt gttatgtgcgtgttctggtgcaagcaagggtgcatgaattgtgg
Download
page-top