Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ304551
Length 558 bp
Fasta Format > whyd9k06
ttcggcacgaggcttcggtcgccttccgattcgaacctcccccaaatccg cagcagtcgacaggaggccaagccaccgcgatggcccgtacgaagcagac cgcccgcaagtccaccggcggcaaggcgccccgcaagcagctcgccacca aggcggcgaggaagtcggcgccgaccaccggcggagtgaagaagccccac cgctacaggcccgggaccgtcgccctccgggagatccgcaagtaccagaa gagcacggagctgctgatccgcaagctgccgttccagcgcctggtccgcg agatcgcgcaggacttcaagaccgacctccgcttccagtcccacgccgtg ctggccctccaggaggcggccgaggcgtacctcgtcgggctgttcgagga caccaacctgtgcgccatccacgccaagcgcgtcaccatcatgcccaagg acatccagctcgcccgccgcatccgtggcgagagggcctaagccgtcctc cccgtcaacgccgttagtggatcggaagtggaatgtgttgcttccggttg tagtttgt
Download
page-top