Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ304849
Length 614 bp
Fasta Format > whyd8j02
gccgacctcgcgtcttctcctgcgcatctcggaggtgcttcctagtttcc acgatgaagctgatcgctgcctacctcctcgcctatctgggtgggaactc ttccccaagtgccgctgacgtcaagaacatcctggactcagttggtgccg aggctgatgaagaaaagcttgagttccttctggctgaactcaaaggcaag gacatcacagaagtgattgcatctggaagggagaagtttgccgctgtgcc ttcaggtgggggtgccattgctgtgggagctccagctgctgcatctggtg gtgccgccgcacctgctgctgagtcaaaggaggagaaggttgaagagaag gaagaatctgatgaagacatgggtttcagtctgttcgactaagcgcttca gttcctcccccctaccctctgtttaccctagtatctgtcgtgtgtggcct gccacaacagcgcctgcataatatctagagacctaaagttcgtgctattt tgcttgggacaatgtatatgtttagtaccttagtatgtgagtgtgttact gcttccgcagcgttgagaagttgattgataatttgctggagttatgtttc tctcaaaaaaaaaa
Download
page-top