Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ300933
Length 443 bp
Fasta Format > whyd5b17
ggcgcggcaagggaggcaaggggctgggcaagggcggcgccaagcgccac cggaaggtcctccgcgacaacatccagggcatcaccaagccggcgatccg gaggctggcgaggaggggcggcgtgaagcgcatctccggcctcatctacg aggagacccgcggcgtcctcaagatcttcctcgagaacgtcatccgcgac gccgtcacctacaccgagcacgcccgccgcaagaccgtcacagccatgga cgtcgtctacgcgctcaagcgccagggccgcaccctctacggcttcggag gctagtagatacgtggtgtgctctgctggtggcggccgtgtttttctgtg ttatatgtgccgtggtggatgggatgtacttctctgtcgtgcgtttgtgt tcactagtctgcaataccattatccgttcaatgaaaaaaaaaa
Download
page-top