Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

This sequence is the data used during the creation of complex contig (registered : 2012 - ), before an accession number is assigned.

Fasta Format

Clone name whxg_36023_i05r
Length 458 bp
Fasta Format > whxg_36023_i05r
TTCACATACGAGCATGCTTTCTCGAGTCATGTCGGGAACATGGACATACA CATATTCTTATCTTAGGAACAAACAAGAAAGATAAATGGAAAAGGAAAAC CCAAAGCAATGTCAGAGTTGACAAAACCGCAATGGCACTTTATATGTGGC CCGTGGTGAGTGAGCTGTTTAGGCCTTGCCGGACTCCTCGCAGCCCGGTG GCTTGAAGGCGATGAAGCTGACGCACTGCACCTGGCGCATGTTGTCGAAT CCGATGATGCGGACATACGCGTCAGGGTACTCCTTCTTGACCTCCTCCAC CTCGTTGATCACCTGCGTGGCGTCGGTGCACCCGAACATAGGCAGCTTCC ACATTGTCCAGTACCGGCCATCGTAGTACCCAGGGGATGCGTTGTGCTCA CGGAAGATAAACCCAACCTTGCTGAACTCGAGGCAAGGCACCCACTTGGA GCGGATCA
Download
page-top