Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ305053
Length 339 bp
Fasta Format > whyd28i08
gccgaggctgatgaagaaaagcttgagttccttctggctgaactcaaagg caaggacatcacagaagtgattgcatctggaagggagaagtttgccgctg tgccttcaggtgggggtgccattgctgtgggagctccagctgctgcatct ggtggtgccgccgcacctgctgctgagtcaaaggaggagaaggttgaaga gaaggaagaatctgatgaagacatgggtttcagtctgttcgactaagcgc ttcagttcctcccccctaccctctgtttaccctagtatctgtcgtgtgtg gcctgccacaacagcgcctgcataatatctagagaccta
Download
page-top