Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ305032
Length 514 bp
Fasta Format > whyd28g19
acgaggggcgcgcgagcgagatcgatcgcgccggaccctagatcccgatg gcctctcgccgccgcaccctcctcaaggtcatcatcctcggcgacagcgg ggttgggaagacttccttgatgaaccaatatgtgaacaagaagttcagca accagtacaaggctacgattggcgccgatttcctcaccaaggaggtgcag ttcgaggacaggctcttcaccctacaaatatgggatactgccggtcagga gaggtttcaaagtcttggtgttgcattctaccgcggtgcagattgttgtg ttctagtttacgatgttaactcaatgaaatcatttgataatctgaacaac tggcgtgaagagtttctaattcaggctagcccatcagatcctgataactt cccttttgttctgctgggtaacaaagttgatgtagatggcgggaatagtc gcgtggtttctgagaaaaaggcgaaggcatggtgtgcctctaaagggaac atcccatactttga
Download
page-top