Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ208717
Length 616 bp
Fasta Format > wh10h10
gnctgcaggnaattcggcacgaggccggcgcggccgcctagggtttacgc catggccgacaagggctgcctcaagcgcctccagaaggagtaccacgcgc tctgcaaggagccggtgccgcagatcgtggcgcgcccgctgcccaacgac atattggagtggcattttgtacttgaaggaagtgtagccacaccctttga aggtggatattactatgggaagcttaaatttccctctgattaccctttta aacctccaagtatcagcatgacaacccccagcggcaggtttgcccctcac aaaaggatatgcctatcaatgagtgactttcatccagaatcttggaatcc catgtggtctgtagcaagcattctaacaggactcctctcatttatgatgg atgatgctcttacaactggaagcatcagaagtacagatggagagaagaag cgtttagctaaggcttctcttgcttacaactgtgagagcaaaaattgccc gcacttcaggaaactgtttcctgagtatgttgagaagtacaaccaacaac tagaaaaggagcaaactggagcggaaccagagccccaggagaaccctgcc ccagctccttctcctg
Download
page-top