Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ305612
Length 654 bp
Fasta Format > whyd26l15
tcccccgggctgaggaattcggacgaggcgtcttcgtactcgcctctctc cgcgcatcctagccttcgccctcctccttccccatttcgccagcggcgca gcccaccaaccacccccacccgccgccatgagggagtgcatctcgatcca catcggccaggccggcatccaggtcgggaacgcgtgctgggagctctact gcctcgagcatggcattcagcctgatggccagatgcccggtgacaagacc gttgggggaggtgatgatgctttcaacaccttcttcagcgagactggtgc tgggaagcatgtcccccgtgctgtctttgtagatctcgagcccactgtga ttgatgaggtgaggactggtgcttaccgccagctcttccaccctgagcag cttatcagtggcaaggaggatgcagccaacaacttcgcccgtggtcatta caccattggcaaggagattgttgatctgtgccttgaccgtatcaggaagc tttcagacaactgcactggtctccagggattccttgtattcaacgctgtt ggaggtggaactggctctggccttggctcgcttctcctggagcgcctctc tgttgactatggaaagaagtccaagcttgggttcacggtgtacccatctc ccca
Download
page-top