Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ305565
Length 574 bp
Fasta Format > whyd26i14
tcccccgggctgaggtcgtactcgcctctctccgcgcatcctagccttcg ccctcctccttcccatttcgccagcggcgcagcccaccaaccacccccac ccgccgccatgagggagtgcatctcgatccacatcggccaggccggcatc caggtcgggaacgcgtgctgggagctctactgcctcgagcatggcattca gcctgatggccagatgcccggtgacaagaccgttgggggaggtgatgatg ctttcaacaccttcttcagcgagactggtgctgggaagcatgtcccccgt gctgtctttgtagatctcgagcccactgtgattgatgaggtgaggactgg tgcttaccgccagctcttccaccctgagcagcttatcagtggcaaggagg atgcagccaacaacttcgcccgtggtcattacaccattggcaaggagatt gttgatctgtgccttgaccgtatcaggaagctttcagacaactgcactgg tctccagggattccttgtattcaacgctgttggaggtggaactggctctg gccttggctcgcttctcctggagc
Download
page-top