Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

This sequence is the data used during the creation of complex contig (registered : 2012 - ), before an accession number is assigned.

Fasta Format

Clone name whxf_31005_k01f
Length 508 bp
Fasta Format > whxf_31005_k01f
TCTCCCCCCGAGCATCGACCATGTCGGCCTACTGCGGCAAGTACAAGGAT GAGCTCATCAAGAACGCTGCCTACATTGGCACCCCTGGCAAGGGTATCCT TGCTGCTGATGAGTCCACCGGCACCATCGGCAAGCGCTTCGCCAGCATCA ATGTTGAGAACGTTGAGGACAACCGTCGTGCCCTCCGTGAGCTCCTCTTC TGCACCCCTGGTGCCCTCCAGTACCTCAGCGGTGTGATCCTGTTTGAGGA GACCCTGTACCAGAGCACCAAGGGTGGCAAGCCCTTCGTCGACATCCTCA AGGCGGGCAATGTCCTCCCCGGCATCAAGGTGGACAAGGGCACCATCGAG CTTGCTGGAACCAACGGTGAGACCACCACCCAGGGCTTTGATGACCTTGG CAAGCGCTGTGCCAAGTACTACGAGGCTGGTGCCCGCTTCGCCAAGTGGC GTGCAGTCCTCAAGATCGGCGCCACCGAGCCATCACAGCTCTCCATCGAC CAGAACGC
Download
page-top