Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ303919
Length 580 bp
Fasta Format > whyd21l13
tcccccaatccgcagcagtcgacaggnaggccaagccaccgcgatggccc gtacgaagcagnaccgcccgcaagtccaccggcggcaaggcgccccgcaa gcagctcgccaccaaggcggcgaggaagtcggcgccgaccaccggcggag tgaagaagccccaccgctacaggcccgggaccgtcgccctccgggagatc cgcaagtaccagaagagcacggagctgctgatccgcaagctgccgttcca gcgcctggtccgcgagatcgcgcaggacttcaagaccgacctccgcttcc agtcccacgccgtgctggccctccaggaggcggccgaggcgtacctcgtc gggctgttcgaggacaccaacctgtgcgccatccacgccaagcgcgtcac catcatgcccaaggacatccagctcgcccgccgcatccgtggcgagaggg cctaagccgtcctccccgtcaacgccgttagtggatcggaagtggaatgt gttgcttccggttgtagtttgttcctaattgccgtgctaggtctatcttc ttctgtgtagaagaaatatggttgttggag
Download
page-top