Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

This sequence is the data used during the creation of complex contig (registered : 2012 - ), before an accession number is assigned.

Fasta Format

Clone name whxe_6038_l12f
Length 676 bp
Fasta Format > whxe_6038_l12f
CGCATCATGCTCGGCATAGGCGCGGTGCCGTCCGTCCTGCTCGCGTTCAT GGTGCTCGGCATGCCCGAGTCTCCCCGGTGGCTCGTCATGAAGGGCCGTC TCGCGGACGCCAAGGTTGTTCTTGCCAAGACTTCCGACACGCCCGAGGAG GCCGCTGAGCGCCTCGCCGACATCAAGACTGCCGCCGGCATCCCTCTGGA CCTCGACGGCGACGTGGTCGCCGTGCCCAAAAACAAAGGAAGCAGCGAGG AGAAGCGCGTGTGGAAGGACCTCATCCTTTCCCCGACCAAAGCCATGCGC CACATCCTCATCGCGGGAATCGGCATCCACTTCTTCCAGCAGTCTTCGGG CATCGACGCCGTCGTGCTCTACAGCCCGCGAGTTTTCAAGAGCGCCGGCA TCACGGGCGACAACCGCCTCCTCGGCACCACCGTGGCCGTCGGGGCCACC AAGACAGTCTTCATCCTGGTGGCCACCTTCCTCCTCGACCGCATCGGCCG GCGGCCGCTTCTGCTGAGCAGCACGGGCGGCGTGATCGTCTCCCTAGTGG GCCTCGCGACGGGGCTCACCGTCATCAGCCGCCACCCGGACGAGAAGATC ACCTGGGCCATCGTCCTGTGCATCTTCTGCATCATGGCCTACGTGGCCTT CTTCTCCATCGGCCTCGGCCCCATCA
Download
page-top