Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ301437
Length 558 bp
Fasta Format > whyd10i23
tcggcacgaggcggcggcggagnacgacggaaacatggtgcagcgcctga cctaccggaagaggcacagctatgccaccaagtccaaccagacgcgggtc gtcaagaccccaggtggtaagctagtgtaccagtacaccaagaagagggc gagcggccccaagtgccctgtgaccgggaagaagatccaggggattcccc acctcaggcctactgaatacaaaagatcaaggttgtctaggaaccgcagg actgtgaaccgtccctatggtggagtgctctctggaactgcagtgaggga aaggatcatccgcgctttcttggttgaggagcagaagatcgtgaagaagg tgttgaaaatacagaagaccaaggacaagacgacctcaaagtaatctgtt tgaaacagaagtgcgaagtgcgatggtgttctgtaaacaaggaaaatatt tttgttggtggttatgatcaatggtttagtcccttctagctaaatgtttt agagtacttgaaatccttctgccgccgtgacatcagagattgtgaaacat ttgatacc
Download
page-top