Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

This sequence is the data used during the creation of complex contig (registered : 2012 - ), before an accession number is assigned.

Fasta Format

Clone name whxe_28078_c19f
Length 604 bp
Fasta Format > whxe_28078_c19f
AGGATGCACCGCTTCATAACCTACAGGCTGGAGAACCAGAAGGAGGTCAT TGTGGACCAAACTGGGGAGCGCGAGGCCACCTATGAGGACTTCACCAAGA CCCTCCCTGAGAATGACTGCCGATTCGCGGTGTTCGACTTCGACTTCACC ACCCCGGAGGATGTGCCAAAGAGCAGGATCTTCTATATCTTCTGGTCCCC GGACACCGCAAAGGTGAGGAGCAAGATGACGTACGCGAGCACCAACGAGA AGTTCAAGAGGACCCTGGACGGCATCCAGATCGAGATGCAGGCCACTGAC CCCAGCGAAATCAGCCTGGACGTGATCAAGGAGCGCGCGCACTAAGGCAA ATCATCCCAATGCCTCGCAATATGGATTTATGTCAAATATAGATTTGGCG GTGTGACTCTTGAAACTTTCTTGATGATTTGTGGCTTTGTTACCGTGTCG AAAGGCCCTCCTCCCGTGGTCCGTGTGACCACGGAGGGCTTGCTCTATCA TGTAATCTGTTCTTTTTCTTCTGCCCATTTATATGCCGGGCCTTATGCTG CTGCACTGCACTGTTCCTCCAAGTTACGGTTATAAATAATTAAATGTTCT GTTT
Download
page-top