Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ301399
Length 545 bp
Fasta Format > whyd10g04
gcatgtgcaagtatgaaccaatttgaactgtgaaactgcgaatggctcat taaatcagttatagtttgtttgatggtacgtgctactcggataaccgtag taattctagagctaatacgtgcaacaaaccccgacttctgggaggggcgc atttattagataaaaggctgacgcgggctctgctcgctgatccgatgatt catgataactcgacggatcgcacggncttcgtgccggcgacgcatcattc aaatttctgccctatcaactttcgatggtaggataggggcctaccatggt ggtgacgggtgacggagaattagggttcgattccggagagggagcctgag aaacggctaccacatcccccgcgggtgaaggcgccgaccccgcgcccccc tccgccggcttcgctccagcccgactccccgggcgtcttcttcaccaacg ctgccgcagctgccccactgggctccgcccaccgccgcatcgccatcgcc gtcgatctgtccgacgagtccgcctacgccgtaagctgggccgtc
Download
page-top