Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ301393
Length 467 bp
Fasta Format > whyd10f19
tgagggagtgcatctcgatccacatcggccggccggcatccaggtcggga acgcgtgctgggagctctactgcctcgagcatggcattcagcctgatggc cagatgcccggtgacaagaccgttgggggaggtgatgatgctttcaacac cttcttcagcgagactggtgctgggaagcatgtcccccgtgctgtctttg tagatctcgagcccactgtgattgatgaggtgaggactggtgcttaccgc cagctcttccaccctgagcagcttatcagtggcaaggaggatgcagccaa caacttcgcccgtggtcattacaccattggcaaggagattgttgatctgt gccttgaccgtatcaggaagctttcagacaactgcactggtctccaggga ttccttgtattcaacgctgttggaggtggaactggctctggccttggctc gcttctcctggagcgcc
Download
page-top