Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ301389
Length 562 bp
Fasta Format > whyd10f05
gggaagccggaaaggggttctcgccgaggcggaaggaggagatggccggg aagggaggcaagggcctgctcgcggccaagacgacggccgccaagaccgc cgagaaggacaaggggaagaaggcccccatctcccgctcgtcccgcgcgg gacttcagttccctgtgggccgtatccatcgtcagctgaagcaaaggact caggccaatggccgtgttggtgctactgcggcggtctactctgctgccat cctggagtacctgacggctgaggtcctggagctggctggcaacgccagca aggatctcaaggtgaagcgtatcacccctcgtcacctccagctggccatc cgtggagacgaggagctcgacaccctcatcaagggcaccattgctggtgg aggtgtgatcccgcacatccacaagtccctgatcaacaagtcttccaaag agtgagaaaatatatagcaaaggagcatctctagcttaaactggacattt tctcagtcgtctgtgagataagtttatcgtcgcgtcgtttagcgtttagc tgtgctccttcc
Download
page-top