Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ301382
Length 368 bp
Fasta Format > whyd10e17
gcatgtgcaagtatgaaccaatttgaactgtgaaactgcgaatggctcat taaatcagttatagtttgtttgatggtacgtgctactcggataaccgtag taattctagagctaatacgtgcaacaaaccccgacttctgggaggggcgc atttattagataaaaggctgacgcgggctctgctcgctgatccgatgatt catgataactcgacggatcgcacggccttcgtgccggcgacgcatcattc aaatttctgccctatcaactttcgatggtaggataggggcctaccatggt ggtgacgggtgacggagaattagggttcgattccggagagggagcctgag aaacggctaccacatcca
Download
page-top