Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ301380
Length 406 bp
Fasta Format > whyd10e13
ttgaaagatacttagtctccaatgatcttcttgttgaatttcaccagcct gttcgtgaagagaaaaagaaggagattgaaggcaaagatgtcgagatggg cttcgacattactcacacaaagcacaaaggacagtatgcactccgcaagt tataccatggaagtccaaggctcattttggttctatatacttctccaaca tgtggtccctgcagaacattaaaaccaattttgaacaaggttatagatga atatgacgaatacgttcattttgttgaaattgacatcgaggaggaccctg aaatagcagaagctgcaggcataatggggacaccatgtgttcagttcttt aaaaacaaagaaatgatcaggactttctctggtgtgaagatgaagaagga ataccg
Download
page-top