Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ301379
Length 354 bp
Fasta Format > whyd10e11
gaggggcggcttcccaggcatgccccagcccccgtgccccctgtggaggt cgggagctccggcggcgggggtagttggttcggcggcctcttcggcaaga aggaggaggagaagaagcccagcggcagcggcggcaagtcggagatatta gagagctttgatacgcccagccctccgataccttcgttcgactacaagtg aaaaaaaaggtagctgatggcgccgatgcgcagcggcgctcgatccacaa gtagtagtctgaagctgggagtgcaatctacttcatcttgtcggaggggt agacaagtgacgcttgcgcagctcaacttctagtactgttatctatgggc tgac
Download
page-top