Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ301372
Length 582 bp
Fasta Format > whyd10d24
gagaactngattgtgaagcagttatgggcatatatcaggcagaataatct tcaggatcctgatgacaaaaggaagattatatgcaatgatgaacttcgta ttgtttttggaaccgactccactgacatgtttaagatgaacaaattgttg gccaagcacataactcctcttgacccaaaagatcaaccttcggaagcaaa aaagattaaggctgccactccagctcctcaacaaatgcctactataaatc aaaatcagccctatgtggttgtttctgatgcgctagccaaattccttggt gtagaaggaacggtgcctcatgatgatgccctcaagtacctttgggatta cataaaagcaaatcagcttgaggatcctgcgagtgcatcaatactatgtg attccagtctgcaagagctgttcggctgcgagagcattccagcttcagga ttatcagacttgcttgctcaccatttcatccaaaggacatagcatatcct cattaactgatgtaggatcgcagcggtgccagataggcctaactttacag aaatggtgttcttacaaaatggacagcgtagc
Download
page-top