Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ301363
Length 616 bp
Fasta Format > whyd10d11
gcgccgccgccgttcccctccggcaacctggctgggatggcatcacgctg cgaaggcaagacaaccggcgacaaaggctactgtagtgtgatttattcac cctatccacagtcgtcgcctcttcctcctcgcctgaccgacctgttccaa cactttggtctggacaagatccgcgcgatcatgaacagttctgatggtaa gacgttcgagcaaaagatcgacaagttacgagaggaaatgagtgctttcg aacgtgctcgtgatgtattctacatcgtcgagggcgaggatggcgacgag gacgacgaaggcgacgaggacgacgacgtggatgtggacgagtcggatag aaagctcttagatgatgaaaagaaacccgatatcacgaaacgaccacaca ctcctattggagatgaggtggaatgcaagaagccaaagatagcagaaggc tcaaggtgccaaggagaagaacctgaggctggagggataaagaattcctc ctgggtctgatgacaggggaatgcagtaaacaccagaagcatcaaaacta tgatctggaacagtatcctgaataaactattttctggattatgaatgaat tctgaagcatggggct
Download
page-top