Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ301352
Length 620 bp
Fasta Format > whyd10c18
gagaagccgcgggcgcccaggnagccgcagcgcaagcccgatggcgtctc gcgcgaggtgtacgcgctcaccggaggggtcggaatggcgccgctcatgc cgaccatcgaggcctcgcacctgaagcgccggcctgctgtcgagaaggag aaggtagcatggcagtggctgcctttcacgtcatctgcacgaactgacaa tctgcaactttaccactgggttagagttgtaaataatgttccaccaactg gtgattatgacttcgcaaaatataacacgaaggtggatgttcttaaatac accgatgaggagtatgagaaatatttaactgaacctgtagacatggagca gagaagaaacagatcagctatttgaattatgtcagcgctttgaccttcgt ttcatagtaatagcagataggtttccaactgctcgcagtgtggaagatct aaagagccgttattattcagttactagggcccttctaattgcaagagctc gatcattcgatgaagttgccggaaaccctcttgtgaaggaaaccttcaat gctgctcatgagactgagagaaaacgtgcattgtctgcactcttctccca aacaaaacagcaagaacgaa
Download
page-top