Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ301345
Length 411 bp
Fasta Format > whyd10c08
aggggcgagcattgagtttaggaaccctggcatggaggacgacccgacct gcgggcctatccttgacaacgtggccatcaagaagctcttctcccccgac aaagcaaaggagaacatggtgatcaatggagactttgaggaggggccatg gatgtttccaaacacaagcttcggtgtcctgctcccgacgaaccttgacg agcagacatcggccttgccagggtggatgatcgagtcgaaccgcgcagtn cgcttcgtcgactccgaccagtacaccgtgccccaggggaagcgcgccat cgagcttctctncggcaaggagggcatcatctcgcagatggtggagacga cccctcagaaggcgtacaccctgacgttcacgctgggctcggcaggcgac tcgtgccagcc
Download
page-top