Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ301338
Length 568 bp
Fasta Format > whyd10b23
ttcggcacgagggcctagaccgccgccaccctccgccgccgccggttgac atggagttctggggccttgaggttaagcctaaccagtccctcaaggtttc acctgatgatgaccacttcctccatctctcccagggtgcccttggtgaag tcaagaaggatgacaaggctaccatgttcgtcaagattggcgaccagaag ctagccatcgggaccctctctactgacaagttccctcagatccagttcga cctcgtctttgagaaggagtttgagctctcacacaattccaagacgtcca gcgtcttcttctctggctacaaggttttccagcctgccgacggagatgag atggattttgattccgaggaagagtctgaggaggagcaagacaccatcat tccagcactcaccaaggagaatggcaaacctgaagccaaggagcagaaga agcaggttaagattgacactgctgccccttcaaagtccaagcctgctgct aaggatgggggaaaatctaacaaggatgatgacagcgatgatgatgatga cagtgatgaggatgacag
Download
page-top