Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ301335
Length 419 bp
Fasta Format > whyd10b19
gcaggaattcggcacgagggcttaacctccccgcacggatcgcggagctg gttgcctcccacttctccggcggccgccgcgttgcagagacgtttcagta tgaggaagggcgcggagctcttggccctgctggtggcgtcgtccctctgc ctgtctgctgcgatcgccgcccaggaaacctgcccggccgacattgacgc caagtgcggcgatgccgcttccgatggttgggagggcgagttcttccccg gcattaccaagatcagatatgagggtccaaccagcaagaagccgctttct tacaagtggtataacgtggaggaagtgattcttggaaagaaaatgaaaga ctggctgcggttcagcgtggcgttttggcacactttccggggtactggag gagacccttttggtgcggc
Download
page-top