Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ301332
Length 217 bp
Fasta Format > whyd10b15
gagaacggcggtcaggtctatatggatggagctaacatgaacgctcaggt tgggttgacaagccctggttttattggagcagatgtttgccatcttaacc ttcacaagacattttgcattccacatggtggaggtggtcctggcatgggt cctattggtgtcaagaagcacttggcgccatttttgccatctcatccagt gatccccactggtggct
Download
page-top