Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ301325
Length 486 bp
Fasta Format > whyd10b07
gcgatcgaatccttccgtcgcgttcgcgtttccgtttcgtgcgtttagac caagcttccaatggctcctctcggtgacgctgttacccccgcggcggccg ccgccgcccctggcctcgtcgtctctttcggcgagatgctgatcgacttc gtgcctgacgttgccggcgtttccctcgccgagtccggcggtttcgtcaa ggcccccggcggcgcccccgccaacgtcgcctgcgccatctccaagctcg gcggctcctccgccttcatcggaaagtttggcgacgacgagttcggccac atgctggtggagatcctgaagcagaacggcgtgaacgccgagggctgcct gttcgaccagcacgcgcgcaccgcgctggccttcgtcacgctcaagtcta acggcgagcgcgagttcatgttctaccgcaacccgtcggccgacatgctg ctcaccgaggctgagctcaacttggacctgatccgc
Download
page-top