Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ301305
Length 603 bp
Fasta Format > whyd10a04
gggctgcaggnaattcggnacgagggtgctgatgaccgtcgccgacttca gcgaccagtacacggactaccaggacaagctgttccgcaacgacgacggc cgcctcgagttcgccggcgacaactgggccgcgctctggccggggaccgg aaagcccgggctgtggatgagcgccatgtccaggctcgccgcgctgtacc gcctcatcgccaccgacgagcagctccgccacatggaacaagaggggtcg acgaagacggcggcaggggacgaacaggacgaggggctggagctctgcat cccgcccgtgttcgaccggtgcagcaaggtgctggaccccggcgagcaga tcgcggcgagggacctgtactgggaggcgatctgcagcgacggcaaggag ggcgtggagtcgctgctgcggcgctgcatcgtgaagaacccgtacgtggg ggagccgtggctggtgctggctcaggtgctgctgaacgaaggagggaggt gggaggaggcggaggcggcggcggcggaggggctgaggctggtgctggag tggggcagcagctgggacaagaggatgtcgtgggaggggttgggtgtcgt ggg
Download
page-top