Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ285749
Length 604 bp
Fasta Format > rwhr9m11
caggttcttacacacaacaggttgtaaaacaaacaccacaaagcaaacgt tcaaacagacagataacagataaagccactcgggcagatcataggatagc agtagcaagccttgggaaagcaccaggaggcaggcttaatactcatcgcc ctcatcaccgtcctcaccctcgtcgaactcagcaccaacttcttcatagt ccttctccagggcagcgagatcctcacgggcctcagagaactctccctcc tccatgccctcaccgacgtaccagtggacgaaggcacgcttggcgtacat caggtcaaacttgtggtcgatgcgggagaagacctcgacgacactggtgg agttggagatcatgcacacagccctctggaccttggcaaggtcaccgcct gggacgacacctggtggctggtagttgataccacacttgaagccagtggg gcaccagtcaacaaactgaatagtgcgcttggtcttgatggtggccacag cagcgttgacgtcctttggcacaacatcaccacggtacatgagacagcag gccatgtacttgccgtggcgggggtcgcacttgggtcgcgcgcttcagcg ccat
Download
page-top