Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ285638
Length 553 bp
Fasta Format > rwhr9e05
gaaatgaaactgcaatgggttaaatgtttacaatctctgatgtacggcgg cagaaggatttaagtactctaaaacatttagctagaagggactaaaccat tgatcataaccaccaacaaaaatattttccttgtttacagaacaccatct cacttcgcacttccgtttcaaacagattactttgaggtcgtcttgtcctt ggtcttctgtattttcaacaccttcttcacgatcttctgctcctcaacca agaaagcgcggatgatcctttccctcaccgcagttccagagagcactcca ccatagggacggttcacagtcctgcggttcctagacaaccttgatctttt gtattcagtaggcctgaggtggggaatcccctggatcttcttcccggtca cagggcacttggggccgctcgccctcttcttggtgtactggtacacgagc ttaccacctggggtcttgacgacccgcgtctggttggacttggtggcata gctgtgcctcttccggtaggtcagacgctgcaccatgtttccgtcgtctc cgc
Download
page-top