Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ284991
Length 497 bp
Fasta Format > rwhr6c14
atctagcgcaacccgagttcgcaaataacaaacatcaggcaaaacttaaa aacgacggttccaggaacataggtctatatccttgaagataactggctat agcaaaacgactcaacgcctcagaatcaggccttggcagcagcctgggca gcggcatcccgcttcctctgctcctcaatgatggtgagcttgataccctt gcccttggggaggctcacccacggcttggtgcccttgccgatggtgaaca cgttgcccagacgggtggcaaactggtggccctgcgcatcctcaacgtgg atggtctcgaaggttcccttatgcttctccctgttcttgatcacaccaac acgcccagtgttgcgcccaccagtaaccatgaccacattgcccgacgtca aacttgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggt gtcattggccttgatgagtgggtctgggtagcggatggtgcggccat
Download
page-top